hsa-miR-3140-3p

miRNA hsa-miR-3140-3p
miRBase Stem Loop Id hsa-mir-3140
miRBase Accession MIMAT0015008
Family mir-3140
5' NA
3' MIMAT0015008
Chromosome chr4
Precursor AGCCTACCATTTATGTCCTCTTGAGGTACCTGAATTACCAAAAGCTTTATGTATTCTGAAGTTATTGAAAATAAGAGCTTTTGGGAATTCAGGTAGTTCAGGAGTGACTTTTCTA
Mature AGCTTTTGGGAATTCAGGTAG
RNA central Id

Color coding for Graphs

Input miRNA

Gene

TF

miRNA and Targets

0%

Association with High Altitude Experiment

Experimental Group Experiment Altitude Duration of Experiment Level of Expression Fold Change Geo No. Associated as Biomarker Reference

Feed Forward Loops

miRNA-FFLs

miRNA TF gene

TF-FFLs

miRNA TF gene

Drug Association

DRUG Gene PMID

Disease Association

Disease PMID

Tissue Association

Gene Ontology

miRNA Category Count Genes GO ID Percentage Value Term

KEGG Pathway

miRNA Count Kegg ID Genes Percentage Value Term